Macky3654 Macky3654
  • 01-03-2016
  • Mathematics
contestada

Find all the powers of 4 in the range 4 through 1,000 what do i do for this?

Respuesta :

Naima26 Naima26
  • 01-03-2016
4^1 = 4
4^2 = 16
4^3 = 64
4^4 = 256
Answer Link

Otras preguntas

Molly is buying a house for $202,000. she is financing $185,500 and obtained a 30 year fixed rate mortgage with a 5.125% interest rate. How much are her month
If o- can give to every other blood type, why cant it recieve other blood types
PLEASE HELP ME ASAPPP Identify the base of a triangle in which h = 5 ft and A = (5x + 20) ft2 .
Which of the following shows the graph of y=In(-2x)
Brainliest!!!!!!!! Which person might most rely on implied meanings when they speak or write A) government official writing a report B) judge delivering a
Less developed countries (LDCs) have a/an____ population growth. A.average B. negative C. positive D. unchanged
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Can things of aluminum have a greater mass than things made of iron?
Which aspect of communist economies kept them from matching the production efficiency and quality of free market economies
Need help ASAP !!!!!!!