tfornwalt3212 tfornwalt3212

03-08-2019
Biology

contestada

List three physical requirements for microbial growth.

Respuesta :

anirudhkp2004 anirudhkp2004

03-08-2019

Answer:

Don't know

Explanation:

Refer to aguide..

Answer Link

sabby18 sabby18

03-08-2019

Hi... I hope this helps, I think the answer is
A specific pH, a temperature depending on the species and somewhere that contains nutrients such as nitrogen
I would love it if you thank me! Good luck

Answer Link

Otras preguntas

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Lisa sells cars for a salary of 2500 per month plus 2% commission of her total car sales. What should her total of car sales be to earn 3500 a month

NEED HELP ASAP ! Look at pic

What impact do you think music has on society as a whole in our modern world? Explain. Give specific examples in your explanation.

I would like some help

THIS IS MUSICCCC Give the letter names if the pairs of notes which are a semitone apart in the major scale of F

He wanted (see) the house where the president was born.

A rabbit hopped down the street, the street was 90 yards long and he did it in 9 seconds, what was his average speed?

What is the role of ATP in living organisms? O lt activates enzymes of the body. O It increases the immunity of the body. O It provides energy for the cellular

Nepal is a country of multiplicity justify this statement with example