oliver6180 oliver6180

02-12-2019
Mathematics

contestada

Are coplanar points in the same line?

Respuesta :

keithdariusbelyue keithdariusbelyue

02-12-2019

Answer:

I am not sure what you mean by same line but a CO planar point have to both share the same plane so not necessarily the same ray or line segment but it has to be on the same plane

Step-by-step explanation:

Answer Link

Otras preguntas

Solve for x in terms of the other matrices and/or their inverses. x=b+ax

An element's atomic number is 64. How many protons would an atom of this element have?

Dr. shiguli wants to determine the lightest touch that can be felt by various animals compared to human beings. he would therefore be interested in finding the

I need the answer and the path work ok

Improved functional health can be a positive influence on which health risk/

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Cell respiration why does a runner breathe hard after finishing a race

Percy Bysshe Shelley's poem "Ode to the West Wind" is significant because it A. explores the human need for love and companionship. B. uses satire to make fun

NEED HELP FAST!!! The difference of the values of the third quartile and the median of the data set represented by the box plot is (Pictured Below)

Brainliest!!!!!!!! Which person might most rely on implied meanings when they speak or write A) government official writing a report B) judge delivering a