warnet
warnet warnet
  • 04-02-2020
  • Mathematics
contestada

cosx = 1/2
tan X = 0 solve​

Respuesta :

kosala1478
kosala1478 kosala1478
  • 04-02-2020

Step-by-step explanation:

see the answer in the pic

Ver imagen kosala1478
Answer Link
PSN03
PSN03 PSN03
  • 04-02-2020

Yo sup??

I am gonna provide you with the particular solution of 1st quadrant nd not the general solution.

cosx=1/2

x=60 or x=π/3

tanX=0

X=0 or 0

Hope this helps.

Answer Link

Otras preguntas

Which aspect of communist economies kept them from matching the production efficiency and quality of free market economies
Which graph is a translation of f(x)=x^2, according to the rule: y=(x-2)^2
Bartók's Concerto for Orchestra is written for A. full orchestra and singer. B. string quartet and orchestra. C. full orchestra. D. full orchestra
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Why do you think the Little Rock Nine deserve to be admired? Give two reasons for your opinion.
define intrinsic motivation
Help with geometry!!!
Write a review of your favorite TV programme.Include the name and type of programme, a description of the programme and why you like it.
What is the lowest level of measurement that a median can be computed?
Please help with geometry!!!