vikky85 vikky85
  • 03-12-2020
  • Chemistry
contestada

help with this question

help with this question class=

Respuesta :

vinny1203 vinny1203
  • 03-12-2020
Complementary DNA strand have the letters switched from each other. That would be:

A -> T OR T -> A
And
C -> G OR G -> C

As well as the direction of the strand:
5’ -> 3’ to 3’ -> 5’


For the first set:

DNA: 5’ - ATTATCGCGTAGCTAGCAGT - 3’
Comp: 3’ - TAATAGCGCATCGATCGTCA - 5’

As you can see the strands are the opposite from one another.

Try out the second set of strands and if you’re still having struggles let me know in the comments (:
Answer Link

Otras preguntas

How many prime numbers are there between 56 and 100?
How do you say little sister, little brother, older sister, and older brother in Korean? I hope someone who actually know Korean can answer this question.
If 4x+5y=10 and x+3y = 8 then (5x+8y)/3=
If 4x+5y=10 and x+3y = 8 then (5x+8y)/3=
What caused the rise of military government in Japan?
A midwestern music competition awarded 35 ribbons. The number of blue ribbons awarded was 3 less than the number of white ribbons. the number of red ribbons was
Most autotrophs make “food” through the process of a. photosynthesis. b. homeostasis c. chemosynthesis d. cellular respiration
If y^8= 4 and y^7=3/x, what is the value of y in terms of x?
Which technological development enabled European navigators to determine their location during the Age of Exploration? (1) lateen sail (2) astrolabe (3) cross
Estimate the angle of elevation from the trailhead to the summit.