abigail5539 abigail5539

03-02-2021
Mathematics

contestada

If Oscar can make 5 doughnuts every 2 minutes, exactly how many minutes
would it take him to make 36 doughnuts?

Respuesta :

dag5nhw3wq dag5nhw3wq

04-02-2021

The answer is 14.4 minutes

Answer Link

Otras preguntas

which function has the solution set shown in the graph?

What value is added to both sides of the equation x2 − 2x = 10 in order to solve by completing the square? A. -1 B. -2 C. 1 D. 2

15 points to whoever can answer this question!!!! Five countries are competing in the high jump at the Olympics. Each country reached a certain height ( meter

Find the measure of an exterior angle of each regular polygon: 100-gon.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Don’t know how to this, solve for x

How did the Berlin Wall change the course of the Cold War? Please Give Three Reasons How, Thank You

Joe has always believed that he is lousy at athletics. when he tried to play soccer, he was sure he would not be good at it, and indeed, he was not very adept.

Kalina is choosing a sandwich and a drink for lunch. She can choose between turkey, ham, and vegetarian sandwiches. She chooses her drink from a selection of wa

Raquel recently received a poor grade on a school assignment. Her mother has noticed that Raquel is staying up late at night and hides in her room. Raquel is re