jackhrwd jackhrwd

02-03-2021
Mathematics

contestada

I need to hire an expert I know it sounds crazy but here’s my number 252-883-1019 im going to send u 5 questions for math I need you to explain to me and you reward will be 20 points + today I will give you 20 points every hour

Respuesta :

Ivangtr2007 Ivangtr2007

02-03-2021

Literally just post the questions and wait for someone to respond there’s no need to give out your number

Answer Link

Аноним Аноним

02-03-2021

Answer:

You shouldnt give out your number to strangers on the internet

Step-by-step explanation:

Answer Link

Otras preguntas

What is the surface area of a cylinder use 3.14 instead of pi button on your calculator the radius two the height is eight. Please help and if any of you do ix

There are 1,000 grams in a kilogram.How would you convert 600 kilograms into grams?

Let y = safe load in pounds and x = depth in inches for a certain type of rectangular horizontal beam. A constant of proportionality exists such that y = kx2. D

Use MATLAB to obtain the roots ofx^3+ 13x² + 52x + 6 = 0

Kermit's favorite iced tea is made with 151515 tea bags in every 222 liters of water. Peggy made a 121212-liter batch of iced tea with 909090 tea bags.

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

Many people vote because of a single issue like abortion. Political scientists have identified these voters do be driven to the polls by A) salient issues. B) p

Imagine there was a campaign to wipe out all bacteria. Why would this not be a goodidea? In your answer, include the terms amino acids, ammonia, nitrites, and n

What do Jessica and Lorenzo think of Portia? Why is their opinion important enough for Shakespeare to show?

Elena is trying to figure out how many movies she can download to her hard drive. The hard drive holds 500 gigabytes of data, but 58 gigabytes are already taken