hoiihh hoiihh
  • 04-03-2021
  • Physics
contestada

someone help please !!

someone help please class=

Respuesta :

alonzorogelio73
alonzorogelio73 alonzorogelio73
  • 04-03-2021

Answer:

c.

is the answer please brainliest

Answer Link
ariel1074
ariel1074 ariel1074
  • 04-03-2021
I’m pretty sure the first one is the correct answer
Answer Link

Otras preguntas

While speaking with cassius, what military action does brutus want to take?
Solve for x. Assume that lines which appear tangent are tangent.
Can you give me a short summary (only in 1 or 2 sentences) on Shakespeare’s Macbeth. And what it is.
What is the solution to the following equation? 5(2x − 14) + 23 = 7x − 14 11 14 30 36
At a fast food restaurant, four friends each ordered a sandwich for $4.89 each and a drink for $1.69. What is the best estimate of the amount of change they wil
How might the history of korea have been different if united nations forces had not stepped into oppose the north korean invasion in 1950?
Need help ASAP !!!!!!!
Characteristics of the early u.s. navy "super frigates" included ______________. select all that apply.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Frederick douglass' ability to read and write furthered the ______________ movement that ultimately put an end to ________________ in the u.s.