pariso82 pariso82
  • 03-05-2021
  • Biology
contestada

Template Strand - A-T-G-C-A-T-G-T-C-A-C-C
T-A-C-G-T-C-A-G-T-G-G|
2. You just wrote in the template strand of DNA. Use the template strand to transcribe a strand
of mRNA
mRNA

Respuesta :

clarareina04 clarareina04
  • 03-05-2021

Answer:

UACGUACUGGAUGCAGUCACC

Explanation:

Answer Link

Otras preguntas

Which of these Gothic conventions is depicted in Percy Bysshe Shelley’s verse drama The Cenci? A. supernatural events B. obsession with the past C. ancestral cu
In Denmark, the personal income tax rate is 55 percent. One of the reasons workers are willing to pay this is because they know they will reap the benefits late
B Christian installed an electric pump to pump water from a borehole into a 30 000 litre cement dam. If the water is pumped at a rate of 75 litres per minute. H
Find the volume. Area = 16.4 cm² 8.1 cm cm³
Need help with this
What’s the second step to solving 2x-4=26
Explain how family roles and responsibility influence health behaviors
Four hundred seventy-six thousandths as a decimal number.
The recording of transactions and events is called:.
Aristarchus was an astronomer who taught that the sun was a. the chariot of Apollo. c. revolving around the earth. b. the center of the universe. d. collapsing.