Valcat Valcat
  • 02-11-2021
  • Mathematics
contestada

What is the slope and y intercept of the blue line

What is the slope and y intercept of the blue line class=

Respuesta :

khanhailey33 khanhailey33
  • 02-11-2021

Answer:

i think its y=3 and the x=2

Step-by-step explanation:

I hope this helps

Answer Link

Otras preguntas

18x^2 −3 will give brailiest
NEED HELP BADLY!! A car with an initial velocity of 22 m/s is accelerated at a rate of 7.3 m/s/s for 6.8 seconds. What is the cars final velocity?
can somebody please look at my recent question for help because it seems like nobody is reading mine when I rlly need help.​
who discovered terracotta soldiers​
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
4. How long will it take a car travelling with a speed of 160 km hr to cover a distance of 700 meters? Hint: km/hr should be converted to m/s​
What is Lincolns main idea in his speech?
What does the use of the term hibakusha indicate? The effects of the atomic bombs were limited to Nagasaki and Hiroshima, so a new term was coined to identify t
why is augustine's view chosen by the orthodox church?
Joey scored 697 points by collecting 17 coins. In all, how many coins does Joey have to collect to score a total of 820 points? Solve using unit rates.