wolverin77830 wolverin77830

02-11-2021
Mathematics

contestada

Evaluate when a=3, b=-1, c=5, and d=-2.

c-7=

Respuesta :

coleyrehanna2007 coleyrehanna2007

02-11-2021

Answer:

=d

Step-by-step explanation:

c=5 , 5-7= -2.............

brainliest pls

Answer Link

Otras preguntas

A steady increase in global temperature has been recorded between 1900 and today. Before concluding that this rise in temperature is the result of the increased

Squirrels and other small mammals near Arizona's Grand Canyon are shown to have experienced speciation. Two populations of antelope squirrels that were original

The importance of structural functionalism is that it A. helped anthropologists understand the evolution of political systems B. showed that violence and chaos

What has enfield learned about the run down labratory

many americans were attrcted to the idea of john l sullivan because they agreed that the united states

explain how you would calculate the molar mass of h2o2?

I NEED TO TURN IT IN 5 MINURGENT I AM GIVING MANY POINTS Past Tense - Match each subject pronoun with the correct –past tense conjugation below of the verb to b

Find the least common multiple of 18 and 24.

Jane Doe is a shop owner in the fictional country of Xanadu. Every month the government’s planning ministry sends her a large booklet (which resembles a phone b

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template