s153592
s153592 s153592
  • 02-02-2022
  • Mathematics
contestada

Find quotient 10/6 / 1/ 24

Respuesta :

MiaTheTaco
MiaTheTaco MiaTheTaco
  • 02-02-2022

Answer:

40

Step-by-step explanation:

Quotient means dividing so we must divide 10/6 by 1/24.

10/6 ÷ 1/24

10/6 * 24/1 = 40 <--- Multiply by the reciprocal in order to divide.

Final Answer: 40

I hope this helps! :)

Answer Link

Otras preguntas

*PLEASE HELP* The Pythagorean Theorem- FIND EACH MISSING LENGTH TO THE NEAREST TENTH. (the numbers are 5.3 and 7.2)
what is 24 divided by 6
You would like to determine if there is a higher incidence of smoking among women than among men in a neighborhood. Let women and men be represented by populati
EXCERPT FROM THE HARVEST GYPSIES PART A: Which statement best expresses the central idea of the text?
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
Solve using elimination. 9x + 3y = -6 9x + 7y = 10
A Pontiac Grand am I Pinterest so will Roger turn pike traveling at 50 mph. Once half an hour later a ford Mustangs enter the turnpike at the same location and
hexagon angle sum of angles use the image below to help you
The weights of 6-week-old poults (juvenile turkeys) are normally distributed with a mean 8.6 pounds and standard deviation 1.9 pounds. A turkey farmer wants to
what is the name of respiration without oxygen