RyanKryster RyanKryster
  • 04-02-2022
  • English
contestada

I don’t read a bible or have one so please help me

I dont read a bible or have one so please help me class=

Respuesta :

Anabam1
Anabam1 Anabam1
  • 04-02-2022
Not too sure if these are correct because it seems like there may be some context from a book?
1. Sin
3. Agustin
6. Matt. 22:38
7. 1 Jn. 4:8

Answer Link
alan21791 alan21791
  • 04-02-2022
1. sin
3. agustin
6. matt. 22:38
7. 1 jn. 4:8
Answer Link

Otras preguntas

For some time, the English had little interest in colonizing for what two reasons?
stuck i need help please
A guaranteed protection against vague laws is known as which of the following?
When you prepare to make a left turn from a one-way road into a two-way road, you must:?
The available farmland in Mali is in the northeast. True or false
Homosociality reflects children's tendency to prefer social interactions with
Need help asappp plzz helppp
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
the push or pull that exists between interacting objects is
An increase in immigrants to Texas led to _________ education. A. extracurricular B. higher C. mandatory D. bilingual