idaliselena0430 idaliselena0430
  • 03-03-2017
  • Mathematics
contestada

How to find a discount percent

Respuesta :

cidebsalon212 cidebsalon212
  • 03-03-2017
If they give you the total price and the price after the discount you can use this "formula" to solve it p/100=b/a where p is the percentage, a is the total price and b is the price after the discount.
Answer Link

Otras preguntas

What is the meaning of Shinto? Where do Gods come from in early Japan?
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
___________________________________, and _______________________________ are a few other terms that are also often used to refer to plant biotechnology. (Please
The slope of the line y = 1/4x + 3 . The slope of the line -2x + 8y = -8 is Are the lines parallel (type Y for yes or N for no) Are the lines perpendicular (t
What pressure will be exerted by 0.450 mol of a gas at 25°C if it is contained in a 0.650-L vessel?
what were the major areas of conflict between nationalism and sectionalism
1 5.8 % 2 6.4 % 3 7.1 % 4 7.3 % 5 7.4 % What should the purchase price of a 2-year zero-coupon bond be if it is purchased at the beginning of year 2 and has fac
Using the rule of 72,= , how long will it take for the principal to double with an annual compound interest rate of 6%?>6 years>9 years>12 years>15
What do you notice about earths axis as earth revolves around the sun?
Simplify the expression: (2x2 + 3x - 7) + (5x2 - x +9)