ash24 ash24
  • 03-04-2015
  • Biology
contestada

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

Respuesta :

flyingcaprinekid
flyingcaprinekid flyingcaprinekid
  • 04-04-2015


the matching (complementary) strand would be:

ATGCCATTCGTAGAACCGTATTGGGGTTAA

Answer Link

Otras preguntas

Is x^2-1 a polynomial
Which are forms of nitrogen that are usable by humans
​a client has been prescribed misoprostol for the treatment of peptic ulcer disease. what is a true contraindication for this medication
A cylinder has volume 45π and radius 3. What is it’s height?
A bus ride for a senior citizen cost $1.25. A monthly pass costs $35. Write and inequality that represents the number of times a senior citizen must ride the bu
PLEASE ANSWER.....If you don’t need to look at a map to tell you were to go, then you probably have a....A. Cognitive load. B. Misperception. C. Photographic me
Which sentence is punctuated correctly? A. My dad loves to cook, however; he hates to do dishes. B. My dad loves to cook; however, he hates to do dishes. C
Which of the following did the West specifically want? high tariffs easy bank credit cheap public land internal improvements at national expense greater acc
how many moles of N2 you have in 476 L sample at STP?
If many different species live in an ecosystem, this helps the ecosystem to fill its _______. a. populations b. niches c. producers d. communities