princesspayton9 princesspayton9

03-12-2017
Mathematics

contestada

Can someone help with this question?

Can someone help with this question class=

Respuesta :

jessicarosa1717 jessicarosa1717

03-12-2017

The answer is A
Because to find the domain we have to be looking at the left side of the circle it starts in -2 from the X axis and it ends on 6 from the X axis
And its the same thing for the range

Answer Link

jennyham jennyham

03-12-2017

The answer would be A. You just look at the places where the circle ends.

Answer Link

Otras preguntas

What is the French name for the Hall of Mirrors? What is the Avenue Trianon?

It takes 10 workers 24 hours to do a job. Fill in the chart.

Sugar melts at 367°F. What is the melting point of sugar on the Celsius scale?

The sterile material that is placed directly on a wound is termed the:

Arrange the steps in the correct order for creating a digital image and saving it.

A 5-card hand is dealt from a deck of 52 cards. what is the probability that 4 are hearts

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Two factors that determine whether a reaction will occur spontaneously

Suppose Naomi gets a sales bonus at her place of work that gives her an extra $600 disposable income. She chooses to spend $360 and save the remaining $240. Fr

I need help with this problem!