khalidinadap82c1d khalidinadap82c1d

01-05-2018
Geography

contestada

what is the meaning of faulting in geography

Respuesta :

stephani2130 stephani2130

01-05-2018

A fault is a planar fracture or discontinuity in a volume of rock, across which there has been significant displacement as a result of rock-mass movement.

Answer Link

HashBrown666 HashBrown666

01-05-2018

A crack in the earths crust resulting in the displacement of one side with respect to the other.

Answer Link

Otras preguntas

A sample of gas at 25ºc has a volume of 11 l and exerts a pressure of 660 mm hg. how many moles of gas are in the sample?

I WILL MARK BRAINIEST AND GIVE 50 POINTS 4. Analyze what would happen to this ecosystem if one of the primary consumers was removed from the ecosystem? What wou

Need help on this geometry please someone ?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Solving this question

allied needs in world war 1 spurred the growth of what industry in Seattle, Tacoma, and Vancouver?A: commercial fishing B: shipbuilding C: textilesD: weapons de

the world-systems approach argues that peripheral nations exploit core nations in various ways True or False

What is the slope of the line that contains the points (10,-3) and (8,-9)?

When did Christianity become the official religion for the Roman Empire

A rectangular garden is 9 feet long and 3 feet wide. A second rectangular garden has dimensions that are triple the dimensions of the first garden. What is the