Seudónimo Seudónimo
  • 01-03-2016
  • English
contestada

Fluency includes emotion, pace, and
a. rhyme.
b. pitch.
c. rhythm.
d. volume.

Respuesta :

taskmasters
taskmasters taskmasters
  • 11-03-2016
Fluency includes emotion, pace and (B) pitch. It is the ability to read a text accurately, quickly, and with expression. Fluency is important because it provides a bridge between word recognition and comprehension. 
Answer Link
zeye zeye
  • 13-04-2020

Answer:

the answer is B pitch

Explanation:

Answer Link

Otras preguntas

Which term refers to the military dictators who took power in Latin America after the Spanish were driven out? A. conquistadores B. creoles C. caudillos D.
what is the geometric mean between 6 and 20?
Why were the committees of correspondence powerful?
The process of chemical cycling is known as a biogeochemical cycle because it A. takes places over a long period of time B. withdraws the
The sum of three numbers is 84 the second number is 2 times the third the first number is 8 more than the third what are the numbers
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
i need help with #3
lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
what is the percent change from 70 to 56?
a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what