ellenaustinn2351 ellenaustinn2351
  • 03-09-2018
  • Social Studies
contestada

What is significant about hester's position in the community now that years have passed?

Respuesta :

andriansp andriansp
  • 12-09-2018

I believe the answer is: The community now sees Hester for her charity works instead of her sin. The letter now means able instead of adulterous.

This shows how people could change their opinion regarding other people's character, regardless of the negative deeds which that person did in the past. From her charity works, hester managed to slowly regained her image in the eyes of the public and make her felt included within the community.

Answer Link

Otras preguntas

Solve the equation -10 + 3x + 5x = -56 ? ??
Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.
Which of the following is NOT a form of formal debate? A. an argument B. policy debate C. parliamentary debate D. Lincoln-Douglass debate
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
Why were the committees of correspondence powerful?
What property is shown by the equation? 1. 0 ÷ (–6) = 0
Did feudalism create a stable form of government?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your
3+1/4x greater than 11