concha50fc concha50fc

02-04-2020
Social Studies

contestada

Why did trade prove difficult at times in ancient Egypt?

Respuesta :

meganmcclain meganmcclain

02-04-2020

Answer:

They couldn't always get to the correct place for trade

Explanation:

Answer Link

Otras preguntas

In a standard dictionary, where can you find the key to pronunciation marks? A. In an appendix B. In the front of the dictionary C. At the bottom of each page D

The Panama Canal connects what two bodies of water?

Complete the sentences with seem, look or sound and use like or as if when necessary. 1) Quick! Emma's an the phone. She... she's calling from a long way away.

How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.

CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n

Complete the sentences with seem, look or sound and use like or as if when necessary. 1) Quick! Emma's an the phone. She... she's calling from a long way away.

a woman lifts a 300 newton child a distance of 1.5 meters in 0.75 seconds. What is her power output in lifting the child?

Please help me!!!!!!!!!!!!!!!!!!!!! Arusha draws a rectangular prism that is made up of two connected cubes, each with side length e. The surface area of a cert