20blunts
20blunts 20blunts
  • 03-11-2016
  • Biology
contestada

What process do animal cells go through to reduce the chromosomes for reproduction?

Respuesta :

mpanderla95
mpanderla95 mpanderla95
  • 03-11-2016
The process that animal cells go through to reduce the number of chromosomes for the process of reproduction is meiosis.
Answer Link

Otras preguntas

Complete the sentences with seem, look or sound and use like or as if when necessary. 1) Quick! Emma's an the phone. She... she's calling from a long way away.
an explanation describe if a square-eyed pet mates with another square-eyed pet, can they have any round-eyed offspring.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Give a recursive algorithm for finding the sum of the first n odd positive integers.
a woman lifts a 300 newton child a distance of 1.5 meters in 0.75 seconds. What is her power output in lifting the child?
an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.
Which is the best description of civil liberties? A. natural rights B. privileges C. rights guaranteed by law D. democratic goals E. trial procedures
Where did middle names come from
Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?
An archer’s arrow follows a parabolic path. The height of the arrow f(x) is given by f(x) = -16x^2 + 200x + 4, in feet. Find the maximum height of the arrow.