leahh738 leahh738
  • 02-04-2021
  • Biology
contestada

question down below! right one will get BRAINLIEST!!!
( any scams will be reported)

question down below right one will get BRAINLIEST any scams will be reported class=

Respuesta :

chickenwing329
chickenwing329 chickenwing329
  • 02-04-2021
A) grasshopper

explanation: there is no water in the food web. the snake is a carnivore and only eats meat (meaning it doesn’t get its energy from grass), the hawk only eats the mice and rabbits. the only choice left would be the grasshopper. (plus it shows the arrow coming from the grass pointing to the grasshopper, implying that the grasshopper gets its energy from the grass).
Answer Link

Otras preguntas

accurate estimation 719-348
In which system of government would states function independently of each other?
Help PleaSE:) ->Grammar Which sentence has a pronoun with an unclear, missing, or confusing antecedent? A. The lifeguards sat in tall chairs; they could
How has water influenced the development of civilization in Africa
An archer’s arrow follows a parabolic path. The height of the arrow f(x) is given by f(x) = -16x^2 + 200x + 4, in feet. Find the maximum height of the arrow.
Which word has the long i sound? relieve speciality society social
Which powerful religious group often tried to close the theaters in Shakespeare's time? A. the Puritans B. the King's Men C. the Pilgrims D. the Jacobites
The Panama Canal connects what two bodies of water?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup