XxAdriennexX XxAdriennexX
  • 02-01-2017
  • Mathematics
contestada

what is the unit rate for the cost of a salad at the salad bar?  

what is the unit rate for the cost of a salad at the salad bar class=

Respuesta :

queenAn1505 queenAn1505
  • 02-01-2017
Unite rate means that there must be a number 1 in the ratio. It is usually on the right part of the ratio so i would divide 2 by 2 and 0.5 by 2. Then you would get 0.25:1

Answer Link

Otras preguntas

Explain who or what "Año Viejo" is and its significance.
How did the mountains in Greece contribute to the rise of city-states?
Solve 2x2 - 8x = -7 Which of the following is a solution of x2 + 5x = -2?
4.2meters= how many centimeter
An archer’s arrow follows a parabolic path. The height of the arrow f(x) is given by f(x) = -16x^2 + 200x + 4, in feet. Find the maximum height of the arrow.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what is 15/24 in simplest form
In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front
Do you think then solid can undergo convection
i need help with #3