salviapony4145 salviapony4145
  • 04-02-2022
  • Chemistry
contestada

Describe the arrangement of ions in a crystal lattice.

Respuesta :

m9ib3ndqpd m9ib3ndqpd
  • 04-02-2022
The ions have a regular, repeating arrangement called an ionic lattice . The lattice is formed because the ions attract each other and form a regular pattern with oppositely charged ions next to each other. ... This is why solid ionic compounds form crystals with regular shapes.
Answer Link

Otras preguntas

The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The process of chemical cycling is known as a biogeochemical cycle because it A. takes places over a long period of time B. withdraws the
How many times does four go into 153 ? What Is the remainder ?
Paulina works out with a 2.5 kilogram mass. What is the mass of the 2.5 kilogram mass in grams?
What is the sum of 6/10 plus 7/12
amy wants to carpet a room that is 12 feet by 8 feet. how many square yards of carpet will she need to complete the room?
Which sentence does not contain any errors in comma usage? A. If you ever visit New Haven, Connecticut, be sure to eat at Sally's Pizza. B. The original Londo
amy wants to carpet a room that is 12 feet by 8 feet. how many square yards of carpet will she need to complete the room?
Which of the following is the modern counterpart of the journal and diary? a. A magazine article b. A blog c. A speech d. A newspaper article