alexisjones1234 alexisjones1234

02-05-2017
Social Studies

contestada

Why did Lee want to link up with General Johnston in North Carolina?

Respuesta :

Emilyramos2903 Emilyramos2903

02-05-2017

Lee abandoned Richmond and retreated west. Lee then made an attempt to escape to the southwest and join up with Joseph E. Johnston's Army of Tennessee in North Carolina.
Hope this helped :)

Answer Link

Otras preguntas

A student government organization is selling Christmas trees as a fundraiser. On Friday, they sold 5 noble fir trees and 3 douglas fir trees for a total of $420

Susan ........ (Run) to school because she was late.

what is the geometric mean between 6 and 20?

5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20

Why is California warm and moderately humid but Nevada is hot and dry? A. The two states are at different latitudes. B. As air moves west over California's mo

A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup

Please help me with this two step math problem! THANK YOU !!!!!!!!

explain, in terms of atomic structure, why group 18 elements on the periodic table rarely form compounds

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

Give a recursive algorithm for ﬁnding the sum of the ﬁrst n odd positive integers.