theconqueror12ovzexs theconqueror12ovzexs
  • 02-10-2017
  • Physics
contestada

How many phases are there in a plant’s reproductive cycle?

A. 1
B. 2
C. 3
D. 4

Respuesta :

messiahswindell messiahswindell
  • 02-10-2017
it's only one because plants are not that big so its A.
Answer Link
kthune95 kthune95
  • 02-10-2017
theres four phases in a plants reproductive cycle!


Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t
Jennie had $300. Then she spent $15 on a new shirt. What percent of the money does Jennie have left
all 231 students in the math club went on a field trip. some students rode in vans ehich hold 7 students each and some students rode in buses which hold 25 stud
how do i find the angles on a kite?
What is the difference between "Herr" and "Herrn"?
how do you know 8 thousandths is less than 1 hundredths
How do I do trebuchet calculations????? Help me please
Which powerful religious group often tried to close the theaters in Shakespeare's time? A. the Puritans B. the King's Men C. the Pilgrims D. the Jacobites
why is it critical to your cells to be near capillaries