sadiyahevans27 sadiyahevans27

03-11-2017
Chemistry

contestada

how do you use a chemical formula to tell how the elements are bonded?

Respuesta :

mylifeizamess62 mylifeizamess62

03-11-2017

In a chemical formula, we can see how many atoms from a certain element has participated for the compound and also we can clearly see what elements have been participated for the conpound

Answer Link

Otras preguntas

A vehicle is only 15% efficient. What happened to the other 85%?

In terms of weather, what kind of boundary does the line labeled X represent? A. occluded front B. stationary front C. cold front D. warm front

Which word has the long e sound? a. client b. inferior c. beautiful d. poetic

how do i find the angles on a kite?

In a standard dictionary, where can you find the key to pronunciation marks? A. In an appendix B. In the front of the dictionary C. At the bottom of each page D

There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

Why is California warm and moderately humid but Nevada is hot and dry? A. The two states are at different latitudes. B. As air moves west over California's mo

A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?

a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what