chandislilly
chandislilly chandislilly
  • 04-01-2016
  • English
contestada

CHECK MY ENGLISH WORK?

CHECK MY ENGLISH WORK class=

Respuesta :

leahpeters
leahpeters leahpeters
  • 04-01-2016
If I am thinking correct that is correct
Answer Link
Аноним Аноним
  • 04-01-2016
Answer: B emotional.
This is because your statement is a emotional statement, leaving you with the correct answer of B
Answer Link

Otras preguntas

what was paul revere failures
how many 1 1/2 centimeter cubes can fit into a rectangular prism that has a length of 12 centimeters , a width of 6 centimeters and a height of 9 centimeters
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
What was religion like in Shang China?
The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The
Companies raise funds to expand their business by
Jennie had $300. Then she spent $15 on a new shirt. What percent of the money does Jennie have left
A vehicle is only 15% efficient. What happened to the other 85%?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
PLEASE HELP I GIVE THANKS