chelsea56x chelsea56x
  • 04-04-2018
  • Chemistry
contestada

What is the empirical formula for a compound that is 7.70% carbon and 92.3% chlorine

Respuesta :

Аноним Аноним
  • 04-04-2018
The answer is, "CH".
Answer Link
Аноним Аноним
  • 04-04-2018
I aced my test and this should be CH
Answer Link

Otras preguntas

what was NOT a primary goal of marriage in a feudal system at the noble level? A. Exchange of land and goods B. love and companionship C. Political arrangement
a antonym for biosphere
Which statement accurately describes the significance of the Magna Carta? A. It gave absolute power to the English king over the church and nobility. B.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what is the lcd of 10/11,29/44
p(x) x^3+x^2-x-1 Find all zeros of p (x)
In which section of his autobiography does Douglass show deep emotion? A.the expression of his affection for other slaves B. the narration of the first few y
In which system of government would states function independently of each other?
5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20
Why did the American public mostly oppose joining the League of Nations after WWI?